Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 3662757
End position: 3662780
Length: 24

DNA sequence
>NC_015381, from 3662757 to 3662780 (24 bp); Burkholderia gladioli BSR3 CGTCGACGCCGACCTCGATGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3662357-3664759	Sequence	bgla_1g32270 - Putative CheA signal transduction histidine kinase (Protein is coded in complementary strand; from 3664759 to 3662357)