Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 3561316
End position: 3561339
Length: 24

DNA sequence
>NC_015381, from 3561316 to 3561339 (24 bp); Burkholderia gladioli BSR3 CAGCACCACCACCAGCAGCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3557090-3561460	Sequence	bgla_1g31300 - hypothetical protein (Protein is coded in complementary strand; from 3561460 to 3557090)