Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 3286058
End position: 3286084
Length: 27

DNA sequence
>NC_015381, from 3286058 to 3286084 (27 bp); Burkholderia gladioli BSR3 AGCGGCGCGAGCCGCGCGAGCAGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3285224-3286624	Sequence	bgla_1g28840 - Polyferredoxin-like protein (Protein is coded in complementary strand; from 3286624 to 3285224)