Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 3264265
End position: 3264288
Length: 24

DNA sequence
>NC_015381, from 3264265 to 3264288 (24 bp); Burkholderia gladioli BSR3 GCCGCCGCCTCCACCGCCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3263678-3264484	Sequence	bgla_1g28580 - lytic transglycosylase (Protein is coded in complementary strand; from 3264484 to 3263678)