Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 3253096
End position: 3253122
Length: 27

DNA sequence
>NC_015381, from 3253096 to 3253122 (27 bp); Burkholderia gladioli BSR3 TATTCGTCCTATTCGTCTTATTCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3253114-3253896	Sequence	bgla_1g28490 - 4'-phosphopantetheinyl transferase (Protein is coded in complementary strand; from 3253896 to 3253114)