Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 3238252
End position: 3238275
Length: 24

DNA sequence
>NC_015381, from 3238252 to 3238275 (24 bp); Burkholderia gladioli BSR3 GCCACCGCCACCGCCGCCGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3237883-3239310	Sequence	bgla_1g28360 - hypothetical protein (Protein is coded in complementary strand; from 3239310 to 3237883)