Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 280313
End position: 280336
Length: 24

DNA sequence
>NC_015381, from 280313 to 280336 (24 bp); Burkholderia gladioli BSR3 CATCGCCATCGGGATCGCGATCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 280092-280808	Sequence	bgla_1g02470 - putative divalent heavy-metal cations transporter (Protein is coded in complementary strand; from 280808 to 280092)