Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 2593939
End position: 2593963
Length: 25

DNA sequence
>NC_015381, from 2593939 to 2593963 (25 bp); Burkholderia gladioli BSR3 GCGAGGCGCGGCGATGCGATTCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2593317-2594507	Sequence	bgla_1g22610 - Beta-ketothiolase (Protein is coded in complementary strand; from 2594507 to 2593317)