Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 2554944
End position: 2554967
Length: 24

DNA sequence
>NC_015381, from 2554944 to 2554967 (24 bp); Burkholderia gladioli BSR3 CCCACCCCCATCCCCGCCCGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2554779-2555666	Sequence	bgla_1g22300 - LysR family transcriptional regulator (Protein is coded in complementary strand; from 2555666 to 2554779)