Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 2524992
End position: 2525027
Length: 36

DNA sequence
>NC_015381, from 2524992 to 2525027 (36 bp); Burkholderia gladioli BSR3 GCGACACCAGCAGCAGCACCAGCAGCGCGACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2523749-2526337	Sequence	bgla_1g22030 - hypothetical protein (Protein is coded in complementary strand; from 2526337 to 2523749)