Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 2513543
End position: 2513572
Length: 30

DNA sequence
>NC_015381, from 2513543 to 2513572 (30 bp); Burkholderia gladioli BSR3 GGCCGGCGCGGGGCGGCGCAGGAAGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2512689-2514425	Sequence	bgla_1g21940 - integrase family protein (Protein is coded in complementary strand; from 2514425 to 2512689)