Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 2473074
End position: 2473097
Length: 24

DNA sequence
>NC_015381, from 2473074 to 2473097 (24 bp); Burkholderia gladioli BSR3 GCCGGTGCCGGTGCCGGTGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2452974-2478299	Sequence	bgla_1g21630 - mixed polyketide synthase/non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 2478299 to 2452974)