Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 2444742
End position: 2444765
Length: 24

DNA sequence
>NC_015381, from 2444742 to 2444765 (24 bp); Burkholderia gladioli BSR3 GCACCGCCACCGGCCCCGTCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2437133-2452909	Sequence	bgla_1g21620 - beta-ketoacyl synthase (Protein is coded in complementary strand; from 2452909 to 2437133)