Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 2270265
End position: 2270288
Length: 24

DNA sequence
>NC_015381, from 2270265 to 2270288 (24 bp); Burkholderia gladioli BSR3 GCTCGCGCTTGCGCACGCGCTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2270252-2271226	Sequence	bgla_1g20220 - fatty acid desaturase family proteiin (Protein is coded in complementary strand; from 2271226 to 2270252)