Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 2265025
End position: 2265051
Length: 27

DNA sequence
>NC_015381, from 2265025 to 2265051 (27 bp); Burkholderia gladioli BSR3 CGAGCAGCACCAGCAGCACGATCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2264049-2265137	Sequence	bgla_1g20150 - secretion protein HlyD (Protein is coded in complementary strand; from 2265137 to 2264049)