Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 2261938
End position: 2261962
Length: 25

DNA sequence
>NC_015381, from 2261938 to 2261962 (25 bp); Burkholderia gladioli BSR3 GCCGGGCAGGGCCGAGCCGATCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2260844-2262397	Sequence	bgla_1g20130 - RND efflux system, outer membrane lipoprotein, NodT (Protein is coded in complementary strand; from 2262397 to 2260844)