Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 2133834
End position: 2133857
Length: 24

DNA sequence
>NC_015381, from 2133834 to 2133857 (24 bp); Burkholderia gladioli BSR3 CCGAGCCCCAGCCCCAGCCCGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2133207-2134043	Sequence	bgla_1g18960 - ABC transporter (Protein is coded in complementary strand; from 2134043 to 2133207)