Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 197527
End position: 197551
Length: 25

DNA sequence
>NC_015381, from 197527 to 197551 (25 bp); Burkholderia gladioli BSR3 CGGCGCGGTGCGCCGCAGCGTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 197459-198559	Sequence	bgla_1g01740 - hypothetical protein (Protein is coded in complementary strand; from 198559 to 197459)