Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 1793973
End position: 1794008
Length: 36

DNA sequence
>NC_015381, from 1793973 to 1794008 (36 bp); Burkholderia gladioli BSR3 GCTCGGTTGCCGGCTCGGTTACCGGCTCAGTTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1794000-1794827	Sequence	bgla_1g16140 - family 3 extracellular solute-binding protein (Protein is coded in complementary strand; from 1794827 to 1794000)