Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 1588797
End position: 1588826
Length: 30

DNA sequence
>NC_015381, from 1588797 to 1588826 (30 bp); Burkholderia gladioli BSR3 CATTGGCATTGGCATTGGCATTGGCATTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1588742-1589020	Sequence	bgla_1g14300 - hypothetical protein (Protein is coded in complementary strand; from 1589020 to 1588742)