Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 1511762
End position: 1511785
Length: 24

DNA sequence
>NC_015381, from 1511762 to 1511785 (24 bp); Burkholderia gladioli BSR3 AGGTCGAGGTCGATGTCGTGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1511525-1512508	Sequence	bgla_1g13630 - Sigma-54 interaction domain/Fis family transcriptional regulator domain-containing protein (Protein is coded in complementary strand; from 1512508 to 1511525)