Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 1410177
End position: 1410224
Length: 48

DNA sequence
>NC_015381, from 1410177 to 1410224 (48 bp); Burkholderia gladioli BSR3 GCCATCGCCATCGCCATCGCCATCGCCATCGCCATCGCCATCGCCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1408339-1410681	Sequence	bgla_1g12650 - aldehyde oxidase and xanthine dehydrogenase (Protein is coded in complementary strand; from 1410681 to 1408339)