Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 1297389
End position: 1297412
Length: 24

DNA sequence
>NC_015381, from 1297389 to 1297412 (24 bp); Burkholderia gladioli BSR3 CGCCACGGCCACCGCCACCGTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1296328-1298628	Sequence	bgla_1g11720 - hypothetical protein (Protein is coded in complementary strand; from 1298628 to 1296328)