Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 1245820
End position: 1245843
Length: 24

DNA sequence
>NC_015381, from 1245820 to 1245843 (24 bp); Burkholderia gladioli BSR3 GCGGCGGCGCCGGCGGTGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1243786-1245882	Sequence	bgla_1g11300 - Phospholipase C (Protein is coded in complementary strand; from 1245882 to 1243786)