Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 1131065
End position: 1131089
Length: 25

DNA sequence
>NC_015381, from 1131065 to 1131089 (25 bp); Burkholderia gladioli BSR3 AGGGCAGCGCATGGCAGAGCTGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1130959-1131723	Sequence	bgla_1g10150 - AzlC family protein (Protein is coded in complementary strand; from 1131723 to 1130959)