Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 1117047
End position: 1117073
Length: 27

DNA sequence
>NC_015381, from 1117047 to 1117073 (27 bp); Burkholderia gladioli BSR3 GCCGACCACGCCGAACACGCCGACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1115737-1117173	Sequence	bgla_1g10020 - cell wall surface anchor family protein (Protein is coded in complementary strand; from 1117173 to 1115737)