Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 4448558
End position: 4448620
Length: 63

DNA sequence
>NC_015321, from 4448558 to 4448620 (63 bp); Fluviicola taffensis DSM 16823 TATAATTCCTAATTCCTAATTCCTAATTCCTAATTCCTAATTCCTAATTCCTAATTCCTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4447660-4448559	Sequence	Fluta_3922 - sulfate adenylyltransferase subunit 2 (Protein is coded in complementary strand; from 4448559 to 4447660)