Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 3271452
End position: 3271507
Length: 56

DNA sequence
>NC_015321, from 3271452 to 3271507 (56 bp); Fluviicola taffensis DSM 16823 TTAGAATTACGAATTACGAATTACGAATTACGAATTACGAATTACGAATTACGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3270109-3271452	Sequence	Fluta_2842 - MORN variant repeat-containing protein