Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 3271549
End position: 3271597
Length: 49

DNA sequence
>NC_015321, from 3271549 to 3271597 (49 bp); Fluviicola taffensis DSM 16823 AATTAGGAATTAGGAATTAGGAATTAGGAATTAGGAATTAGGAATTAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3271594-3272352	Sequence	Fluta_2843 - metallophosphoesterase (Protein is coded in complementary strand; from 3272352 to 3271594)