Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 3896169
End position: 3896210
Length: 42

DNA sequence
>NC_015321, from 3896169 to 3896210 (42 bp); Fluviicola taffensis DSM 16823 TAGTAATTCGTAATTCGTAATTCGTAATTCGTAATTCGTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3896211-3897014	Sequence	Fluta_3391 - hypothetical protein (Protein is coded in complementary strand; from 3897014 to 3896211)