Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 2949069
End position: 2949108
Length: 40

DNA sequence
>NC_015321, from 2949069 to 2949108 (40 bp); Fluviicola taffensis DSM 16823 AGTTCAAATGTTCAAATGTTCAAATGTTCAAATGTTCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2948595-2949071	Sequence	Fluta_2552 - 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase