Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 3488433
End position: 3488468
Length: 36

DNA sequence
>NC_015321, from 3488433 to 3488468 (36 bp); Fluviicola taffensis DSM 16823 GAAAATTCAGATGAAAATTCAGACGATAATTCAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3486898-3489336	Sequence	Fluta_3028 - ATP-binding region ATPase domain-containing protein