Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 1334724
End position: 1334755
Length: 32

DNA sequence
>NC_015321, from 1334724 to 1334755 (32 bp); Fluviicola taffensis DSM 16823 AAACTTTTGAACTTTTGAACTTTTGAACTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1334756-1335931	Sequence	Fluta_1186 - hypothetical protein (Protein is coded in complementary strand; from 1335931 to 1334756)