Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 671851
End position: 671880
Length: 30

DNA sequence
>NC_015321, from 671851 to 671880 (30 bp); Fluviicola taffensis DSM 16823 AAAATTGATTGAAATTTATTAGAGTTGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 671870-673384	Sequence	Fluta_0579 - hypothetical protein (Protein is coded in complementary strand; from 673384 to 671870)