Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 3268024
End position: 3268053
Length: 30

DNA sequence
>NC_015321, from 3268024 to 3268053 (30 bp); Fluviicola taffensis DSM 16823 TTATTGGGTTTTGTTCGGTTTTATTGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3267737-3269611	Sequence	Fluta_2840 - polysaccharide biosynthesis protein CapD