Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 3304771
End position: 3304798
Length: 28

DNA sequence
>NC_015321, from 3304771 to 3304798 (28 bp); Fluviicola taffensis DSM 16823 AATTCGTAATTCGGCATTCGTAATTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3304315-3304821	Sequence	Fluta_2875 - Activator of Hsp90 ATPase 1 family protein (Protein is coded in complementary strand; from 3304821 to 3304315)