Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 1300790
End position: 1300817
Length: 28

DNA sequence
>NC_015321, from 1300790 to 1300817 (28 bp); Fluviicola taffensis DSM 16823 TCTTCATTCTTAATTCTACATTCTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1300818-1302392	Sequence	Fluta_1158 - ATP synthase F1 subunit alpha (Protein is coded in complementary strand; from 1302392 to 1300818)