Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 1368084
End position: 1368110
Length: 27

DNA sequence
>NC_015321, from 1368084 to 1368110 (27 bp); Fluviicola taffensis DSM 16823 CACCGCCAGCACCACCAGCACCGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1367495-1369066	Sequence	Fluta_1211 - hypothetical protein (Protein is coded in complementary strand; from 1369066 to 1367495)