Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 4317599
End position: 4317623
Length: 25

DNA sequence
>NC_015321, from 4317599 to 4317623 (25 bp); Fluviicola taffensis DSM 16823 TTTTTTTTGTTTTTCGTTTTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4317417-4319348	Sequence	Fluta_3793 - 5'-3' DNA helicase (Protein is coded in complementary strand; from 4319348 to 4317417)