Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 3789686
End position: 3789710
Length: 25

DNA sequence
>NC_015321, from 3789686 to 3789710 (25 bp); Fluviicola taffensis DSM 16823 AGAAAAGAAGAGCAAACAAAAGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3789382-3789903	Sequence	Fluta_3308 - hypothetical protein (Protein is coded in complementary strand; from 3789903 to 3789382)