Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 683315
End position: 683338
Length: 24

DNA sequence
>NC_015321, from 683315 to 683338 (24 bp); Fluviicola taffensis DSM 16823 TCTTTTACTCTTATACTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 682977-685469	Sequence	Fluta_0591 - restriction enzyme (Protein is coded in complementary strand; from 685469 to 682977)