Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 554454
End position: 554477
Length: 24

DNA sequence
>NC_015321, from 554454 to 554477 (24 bp); Fluviicola taffensis DSM 16823 ATTTCCATACTTCCATTTTTCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 554398-556185	Sequence	Fluta_0484 - Ser/Thr phosphatase (Protein is coded in complementary strand; from 556185 to 554398)