Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 51235
End position: 51258
Length: 24

DNA sequence
>NC_015321, from 51235 to 51258 (24 bp); Fluviicola taffensis DSM 16823 GATTTTGGTTTTGATTCTGATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 51222-51884	Sequence	Fluta_0052 - hypothetical protein (Protein is coded in complementary strand; from 51884 to 51222)