Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 4606154
End position: 4606177
Length: 24

DNA sequence
>NC_015321, from 4606154 to 4606177 (24 bp); Fluviicola taffensis DSM 16823 TGTTGGTGTAGGTGTGGGAGTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4605150-4606274	Sequence	Fluta_4060 - hypothetical protein (Protein is coded in complementary strand; from 4606274 to 4605150)