Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 3482826
End position: 3482849
Length: 24

DNA sequence
>NC_015321, from 3482826 to 3482849 (24 bp); Fluviicola taffensis DSM 16823 AATAAAAAATTAAAAAAATGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3482443-3482847	Sequence	Fluta_3020 - DoxX family protein
ORF... 3482844-3483287	Sequence	Fluta_3021 - hypothetical protein