Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 2014075
End position: 2014098
Length: 24

DNA sequence
>NC_015321, from 2014075 to 2014098 (24 bp); Fluviicola taffensis DSM 16823 AATTGTAATTCTGATTGTAATTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2012946-2014166	Sequence	Fluta_1753 - hypothetical protein (Protein is coded in complementary strand; from 2014166 to 2012946)