Sequence retrieval

Genome: Fluviicola taffensis DSM 16823
Start position: 1260028
End position: 1260051
Length: 24

DNA sequence
>NC_015321, from 1260028 to 1260051 (24 bp); Fluviicola taffensis DSM 16823 TCCAATTCCAAAACCAATTCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1259933-1262341	Sequence	Fluta_1124 - hypothetical protein (Protein is coded in complementary strand; from 1262341 to 1259933)