Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069
Start position: 723309
End position: 723341
Length: 33

DNA sequence
>NC_015215, from 723309 to 723341 (33 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069 AAGAAAAAGGGAAGAAAGAGGAAAGAAAATGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 722583-723311	Sequence	SGGBAA2069_c06890 - hypothetical protein
ORF... 723338-724003	Sequence	SGGBAA2069_c06900 - hypothetical protein