Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069
Start position: 500958
End position: 500987
Length: 30

DNA sequence
>NC_015215, from 500958 to 500987 (30 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069 TTTGATTTTATTTGATGTTGTTTGATTAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 500824-501372	Sequence	SGGBAA2069_c04620 - hypothetical protein (Protein is coded in complementary strand; from 501372 to 500824)