Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069
Start position: 2352992
End position: 2353021
Length: 30

DNA sequence
>NC_015215, from 2352992 to 2353021 (30 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069 TAGTTTTTTTCAATTTTTTTACGTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2352971-2353078	Sequence	SGGBAA2069_c23060 - hypothetical protein (Protein is coded in complementary strand; from 2353078 to 2352971)